restriction enzymes spei hf (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs restriction enzymes spei hf
Restriction Enzymes Spei Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spei+hf+restriction+enzymes/SpeI-HF/pm41498345-64-0-13
Average 96 stars, based on 1130 article reviews

restriction enzymes spei hf - by Bioz Stars, 2026-09

96/100 stars

Images

Polymerase Chain Reaction:

Article Title: Intrinsic and extrinsic determinants of conditional localization of Mms6 to magnetosome organelles in Magnetospirillum magneticum AMB-1.
Article Snippet: To create pAK1456 (mms699-157-GFP), pAK1444 (mms61-98-GFP), pAK1445 (mms6113-157-GFP), pAK1446 (mms6107-157-GFP), pAK1441 (mms651-157-GFP), and pAK1443 (mms61-139-GFP), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in Table S3 and inserted by Gibson assembly into pAK1102 (mms6-GFP), following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs). .. To create pAK1447 (GFP-mms6NTDmmsF), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in Table S3 and inserted by Gibson assembly into pAK532 (GFP-mmsF), following vector digestion with BamHI-HF and SpeI-HF restriction enzymes (New England Biolabs). .. To create pAK1440 (mamG-GFP), mamG was amplified from AMB-1 genomic DNA using the primers listed in Table S3 and inserted by Gibson assembly into multiple cloning vector pAK22, following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs).

Article Title: Intrinsic and extrinsic determinants of conditional localization of Mms6 to magnetosome organelles in Magnetospirillum magneticum AMB-1
Article Snippet: To create pAK1456 ( mms6 99-157 -GFP), pAK1444 ( mms6 1-98 -GFP), pAK1445 ( mms6 113-157 -GFP), pAK1446 ( mms6 107-157 -GFP), pAK1441 ( mms6 51-157 -GFP), and pAK1443 ( mms6 1-139 -GFP), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in Table S3 and inserted by Gibson assembly into pAK1102 ( mms6 -GFP), following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs). .. To create pAK1447 (GFP- mms6 NTD mmsF ), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in Table S3 and inserted by Gibson assembly into pAK532 (GFP- mmsF ), following vector digestion with BamHI-HF and SpeI-HF restriction enzymes (New England Biolabs). .. To create pAK1440 ( mamG -GFP), mamG was amplified from AMB-1 genomic DNA using the primers listed in Table S3 and inserted by Gibson assembly into multiple cloning vector pAK22, following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs).

Article Title: Neuronal potassium channel activity triggers initiation of mRNA translation through binding of translation regulators.
Article Snippet: The myristylation tag of dendra2 was removed to generate pCS2- ΔmyrDendra2- Actb5′UTR3′ (Δmyr- dendra2) using the Q5 Site- Directed Mutagenesis Kit, substituting NEBNext Ultra II Q5 Master Mix for the kit’s polymerase (forward primer: AACACCCCGGGAATTAACC; reverse primer: CATGGCGAACTGGTGGCG). .. Subcloning PCR product and pEGFP- C1 backbone were cut using KpnI–HF and SpeI–HF restriction enzymes (New England BioLabs) and ligated using Quick Ligase Kit (New England BioLabs) according to the manufacturer’s protocols. .. HEK 293 T cells [American Type Culture Collection (ATCC)] were maintained in high- glucose Dulbecco’s modified Eagle’s medium (DMEM) (Gibco).

Article Title: The localization of magnetite biogenesis proteins in Magnetospirillum magneticum AMB-1
Article Snippet: To create pAK1456 (mms699-157-GFP), pAK1444 (mms61-98-GFP), pAK1445 (mms6113-157-GFP), pAK1446 (mms6107-157-GFP), pAK1441 (mms651-157-GFP), and pAK1443 (mms61-139-GFP), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in supplementary table S3 and inserted by Gibson assembly into pAK1102 (mms6-GFP), following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs). .. To create pAK1447 (GFP-mms6NTDmmsF), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in supplementary table S3 and inserted by Gibson assembly into pAK532 (GFP-mmsF), following vector digestion with BamHI-HF and SpeI-HF restriction enzymes (New England Biolabs). ..

Article Title: Intrinsic and extrinsic determinants of conditional localization of Mms6 to magnetosome organelles in Magnetospirillum magneticum AMB-1
Article Snippet: To create pAK1456 ( mms6 99-157 -GFP), pAK1444 ( mms6 1-98 -GFP), pAK1445 ( mms6 113-157 -GFP), pAK1446 ( mms6 107-157 -GFP), pAK1441 ( mms6 51-157 -GFP), and pAK1443 ( mms6 1-139 -GFP), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in and inserted by Gibson assembly into pAK1102 ( mms6 -GFP), following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs). .. To create pAK1447 (GFP- mms6 NTD mmsF ), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in and inserted by Gibson assembly into pAK532 (GFP- mmsF ), following vector digestion with BamHI-HF and SpeI-HF restriction enzymes (New England Biolabs). .. To create pAK1440 ( mamG -GFP), mamG was amplified from AMB-1 genomic DNA using the primers listed in and inserted by Gibson assembly into multiple cloning vector pAK22, following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs).

Article Title: Neuronal potassium channel activity triggers initiation of mRNA translation through binding of translation regulators
Article Snippet: The pCS2-myrDendra2-Actb5′UTR3′ (dendra2 actin ) construct was a gift from D. Benson (Icahn School of Medicine). myrDendra2-Actb5′UTR3′ subcloning into pEGFP-C1 vector (dendra2-C1) was performed with restriction enzyme cloning using NEBNext Ultra II Q5 Master Mix (New England BioLabs) using the following primers: forward primer: ATA ACTAGT ATGGGCACGGTGCTGTC; reverse primer: AAT GGTACC TAGAAGCATTTGCGTCGAGTCTT); bold represents restriction enzyme target sequences. .. Subcloning PCR product and pEGFP-C1 backbone were cut using KpnI–HF and SpeI–HF restriction enzymes (New England BioLabs) and ligated using Quick Ligase Kit (New England BioLabs) according to the manufacturer’s protocols. .. The myristylation tag of dendra2 was removed to generate pCS2-ΔmyrDendra2-Actb5′UTR3′ (Δmyr-dendra2) using the Q5 Site-Directed Mutagenesis Kit, substituting NEBNext Ultra II Q5 Master Mix for the kit’s polymerase (forward primer: AACACCCCGGGAATTAACC; reverse primer: CATGGCGAACTGGTGGCG).

Amplification:

Article Title: Intrinsic and extrinsic determinants of conditional localization of Mms6 to magnetosome organelles in Magnetospirillum magneticum AMB-1
Article Snippet: To create pAK1456 ( mms6 99-157 -GFP), pAK1444 ( mms6 1-98 -GFP), pAK1445 ( mms6 113-157 -GFP), pAK1446 ( mms6 107-157 -GFP), pAK1441 ( mms6 51-157 -GFP), and pAK1443 ( mms6 1-139 -GFP), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in and inserted by Gibson assembly into pAK1102 ( mms6 -GFP), following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs). .. To create pAK1447 (GFP- mms6 NTD mmsF ), fragments of mms6 were PCR amplified from AMB-1 genomic DNA using the primers listed in and inserted by Gibson assembly into pAK532 (GFP- mmsF ), following vector digestion with BamHI-HF and SpeI-HF restriction enzymes (New England Biolabs). .. To create pAK1440 ( mamG -GFP), mamG was amplified from AMB-1 genomic DNA using the primers listed in and inserted by Gibson assembly into multiple cloning vector pAK22, following vector digestion with BamHI-HF and EcoRI-HF restriction enzymes (New England Biolabs).

Subcloning:

Plasmid Preparation:

Article Title: Methods and compositions for enriching nucleic acids
Article Snippet: .. The vector was linearised with XhoI and SpeI-HF restriction enzymes (both New England BioLabs, Ipswich, MA, USA) and cleaned up using AMPure beads following standard protocol (Agencourt®AMPure® XP, Agilent, Santa Clara, CA, USA). .. The vector was linearised with XhoI and SpeI-HF restriction enzymes (both New England BioLabs, Ipswich, MA, USA) and cleaned up using AMPure beads following standard protocol (AgencourtAMPure XP, Agilent, Santa Clara, CA, USA).

Review